View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21440_low_78 (Length: 206)
Name: NF21440_low_78
Description: NF21440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21440_low_78 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 55 - 196
Target Start/End: Original strand, 2614628 - 2614769
Alignment:
| Q |
55 |
agaaccttcccaagacagtggcaagagtttgaagataagtatcaatcatttggtcacgagaaggtgcaggatccttaggaaactccattacaataagcca |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2614628 |
agaaccttcccaagacagtggcaagagtttgaagataagtatcaatcatttggtcacgagaaggtgcaggatccttaggaaactccattacaataagcca |
2614727 |
T |
 |
| Q |
155 |
atgattgtaatcacaaccaggaagcataattgtctctctctg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2614728 |
atgattgtaatcacaaccaggaagcataattgtctctctctg |
2614769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University