View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21443_low_12 (Length: 321)
Name: NF21443_low_12
Description: NF21443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21443_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 54472913 - 54472712
Alignment:
| Q |
1 |
gcaagaaattccataagcagagaacacatatgtttggtaacaaagttataccaattgtgcagttcctttctatcatcgtcatcttaaaagattaggattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54472913 |
gcaagaaattccataagcagagaacacatatgtttggtaacaaagttataccaattgtgcagttcctttctatcatcgtcatcttaaaagaataggattt |
54472814 |
T |
 |
| Q |
101 |
aaattgtacaacttgtatttatatattacggttcaggcttcaaacccgcgcccctaatcaccccacgcaacttaccttcgtgtaactgtgttggttcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54472813 |
aaattgtacaacttgtatttatatattacggttcaggcttcaaacccgcgtccctaatcacccctcgcaacttaccttcgtgtaactgtgttggttcaaa |
54472714 |
T |
 |
| Q |
201 |
aa |
202 |
Q |
| |
|
|| |
|
|
| T |
54472713 |
aa |
54472712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 195 - 302
Target Start/End: Original strand, 54473084 - 54473191
Alignment:
| Q |
195 |
ttcaaaaaagacacctccgcaccaggttagtagcagtgagttgaccaactccagttactctggcccagtagatcctgtattgccaccaccacacccaacg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54473084 |
ttcaaaaaagacacctccgcaccaggttagtagcagtgagttgaccaactccagttactctggcccagtagatcctgtattgccaccaccacacccaacg |
54473183 |
T |
 |
| Q |
295 |
gttgcact |
302 |
Q |
| |
|
|||||||| |
|
|
| T |
54473184 |
gttgcact |
54473191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University