View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21443_low_17 (Length: 256)
Name: NF21443_low_17
Description: NF21443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21443_low_17 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 21 - 256
Target Start/End: Complemental strand, 45683406 - 45683171
Alignment:
| Q |
21 |
gcccagagcttgcgttgtattgctattgcatacagatcatacgaattggaaaaaattccatccaaggaagaggatttagaccagtggtccttacccgatc |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683406 |
gcccagagcttgcgttgtattgctattgcatacagatcatacgaattggaaaaaattccatccaaggaagaggatttagaccagtggtccttacccgatc |
45683307 |
T |
|
| Q |
121 |
atgagcttgttttgcttgctattgttggaataaaggtaaaacacaagtttctttcacctgtaatgtgttacaaatttgtttcccccataacttgcaactt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683306 |
atgagcttgttttgcttgctattgttggaataaaggtaaaacacaagtttctttcacctgtaatgtgttacaaatttgtttcccccataacttgcaactt |
45683207 |
T |
|
| Q |
221 |
tatgaacaatttagtcctcaatcgttatagtaggta |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45683206 |
tatgaacaatttagtcctcaatcgttatagtaggta |
45683171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 30 - 161
Target Start/End: Original strand, 1443877 - 1444008
Alignment:
| Q |
30 |
ttgcgttgtattgctattgcatacagatcatacgaattggaaaaaattccatccaaggaagaggatttagaccagtggtccttacccgatcatgagcttg |
129 |
Q |
| |
|
||||||||| ||||||||||||||||||| || ||||| || ||||||||||| || || |||||||||| ||| ||||||||||| || ||||||||| |
|
|
| T |
1443877 |
ttgcgttgtgttgctattgcatacagatcgtatgaattagacaaaattccatctaatgaggaggatttagcccaatggtccttaccagaagatgagcttg |
1443976 |
T |
|
| Q |
130 |
ttttgcttgctattgttggaataaaggtaaaa |
161 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
1443977 |
ttttgcttgctattgttggaatcaaggtaaaa |
1444008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University