View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21443_low_20 (Length: 234)
Name: NF21443_low_20
Description: NF21443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21443_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 118 - 219
Target Start/End: Original strand, 1854530 - 1854631
Alignment:
| Q |
118 |
gggatttgtgagggaattgtagtattgcttttattttgtagtggcaaatcaaaaagcaaaggaataatttaaagaaaaattaaaagagcacaatgtgtat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1854530 |
gggatttgtgagggaattgtagtattgcttttattttgtagtggcaaatcaaaaagcaaaggaataatttaaagaaaaattaaaagagcacaatgtgtat |
1854629 |
T |
 |
| Q |
218 |
at |
219 |
Q |
| |
|
|| |
|
|
| T |
1854630 |
at |
1854631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 14 - 89
Target Start/End: Original strand, 1854425 - 1854500
Alignment:
| Q |
14 |
aagaatatcatctactttaaaaaaggggacaaagtttcttagtaaatattgaaatatgataagatgaattatcaag |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1854425 |
aagaatatcatctactttaaaaaaggggacaaagtttcttagtaaatattgaaatatgataagatgaattatcaag |
1854500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University