View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21443_low_21 (Length: 220)

Name: NF21443_low_21
Description: NF21443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21443_low_21
NF21443_low_21
[»] chr8 (1 HSPs)
chr8 (17-201)||(26560327-26560511)


Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 17 - 201
Target Start/End: Complemental strand, 26560511 - 26560327
Alignment:
17 aaaaatttaacgtaaatgtgtgtcccttaaatttgcagtgttagagtaagtaatgaattgggagcagcacatccaagagtagcaagattttcagtaatag 116  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
26560511 aaaaatttaacgtaaatgtgcgtcccttaaatttgcagtgttagagtaagtaatgaattgggagcagcacatccaagactagcaagattttcagtaatag 26560412  T
117 ttgtgaatgggactagccttctcatcagcttagtaatctctgcacttattctaatatttcgagtttcattaagcaaactcttcac 201  Q
    ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
26560411 ttgtgaatgggactagccttctcatcagcatagtattctctgcacttattctaatatttcgagtttcattaagcaaactcttcac 26560327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University