View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21443_low_4 (Length: 487)
Name: NF21443_low_4
Description: NF21443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21443_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 415; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 38 - 472
Target Start/End: Complemental strand, 55383080 - 55382646
Alignment:
| Q |
38 |
gatgatgctgttcaagaggccatggatttagcacctcctgagaccactctatcattgattggtcactcggccggaggatggcttgcgcgtctgtatatgc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55383080 |
gatgatgctgttcaagaggccatggatttagcacctcctgagaccactctatcattgattggtcactcggccggaggatggcttgcgcgtctgtatatgc |
55382981 |
T |
 |
| Q |
138 |
agcagtttggggcgtccaatatatcactgttattaactcttggaacccctcatcatccacctccaaaaggcgtccctggtgttatcgatcaaaccagggg |
237 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55382980 |
agcaatttggggtgtccaatatatcactgttattaactcttggaacccctcatcatccacctccaaaaggcgtccctggtgttatcgatcaaaccagggg |
55382881 |
T |
 |
| Q |
238 |
tctccttgattatgttcaacaatattgctccaaacctgtttacacccctcacctcaagtatgtatgcatagcaggaaggtaacacctacactctttcaag |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55382880 |
tctccttgattatgttcaacaatattgctccaaacctgtttacacccctcacctcaagtatgtatgcatagcaggaaggtaacacccacactctttcaag |
55382781 |
T |
 |
| Q |
338 |
gaaacatacatccctcaaaagtagtcttttttgatactcaacttctacaatttataaaatgcagaccatgccaacacaaacataacttactatacaatca |
437 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55382780 |
gaaacttacatccctcaaaagtagtcttttttgatactcaatttctacaatttataaaatgcagaccatgccaacacaaacataacttactatacaatca |
55382681 |
T |
 |
| Q |
438 |
attattcatttcatttcttactacaaaatgaaggt |
472 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
55382680 |
attattcatttcatttcttactacaaaatgaaggt |
55382646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University