View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21443_low_5 (Length: 410)
Name: NF21443_low_5
Description: NF21443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21443_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 6e-50; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 40273753 - 40273645
Alignment:
| Q |
1 |
ttatgtcttttgttgcttttattcttcaaagttgtactaaatgtcatggttcaagaaaatttagatcttgggtaaactaaaaaactcgaagagttagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
40273753 |
ttatgtcttttgttgcttttattcttcaaagttgtactaaatgtcatggttcaagaaaatttagatcttgggtaaattaaaaaactcgaagagttaggga |
40273654 |
T |
 |
| Q |
101 |
gggttttga |
109 |
Q |
| |
|
||||||||| |
|
|
| T |
40273653 |
gggttttga |
40273645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 4 - 109
Target Start/End: Original strand, 40274484 - 40274589
Alignment:
| Q |
4 |
tgtcttttgttgcttttattcttcaaagttgtactaaatgtcatggttcaagaaaatttagatcttgggtaaactaaaaaactcgaagagttagagaggg |
103 |
Q |
| |
|
||||| |||||| ||||||| ||||||||| || | ||||| ||||||||||||||||||||| || || ||||||||||| | | ||||||| ||||| |
|
|
| T |
40274484 |
tgtctcttgttgtttttatttttcaaagttatatttaatgtgatggttcaagaaaatttagatattaggaaaactaaaaaatttggagagttatggaggg |
40274583 |
T |
 |
| Q |
104 |
ttttga |
109 |
Q |
| |
|
||||| |
|
|
| T |
40274584 |
gtttga |
40274589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 116 - 156
Target Start/End: Complemental strand, 40273138 - 40273098
Alignment:
| Q |
116 |
attgtgtgtctatttatattatgttcttcctagcgcaatat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40273138 |
attgtgtgtctatttatattatgttcttcctagcacaatat |
40273098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University