View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21443_low_9 (Length: 360)
Name: NF21443_low_9
Description: NF21443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21443_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 154 - 353
Target Start/End: Original strand, 9594662 - 9594879
Alignment:
| Q |
154 |
ttttcagtactagcaactactaatgtacataattggcgactgctttgtttgttcatccttgtcttcgctttcttggcgactacaccgtattctgttgtta |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | || || |||||||| |
|
|
| T |
9594662 |
ttttcagtactagcaactactaatgtacataattggcgactgctttgtttgttcatccttgtcttcactttcttggcgactacgcagtgttatgttgtta |
9594761 |
T |
|
| Q |
254 |
tc------------------tggttgcggtgaatcagaaaccgtagcccatttattttttggttgcaacattctcagtttgctttggactcatgtgttac |
335 |
Q |
| |
|
|| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9594762 |
tcttattcggtttgtgtatctggttgcggtgaatcaaaaaccgtagcccatttattttttagttgcaacattctcagtttgctttggactcatgtgttac |
9594861 |
T |
|
| Q |
336 |
actggttgagtctctctg |
353 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
9594862 |
attggttgagtctctctg |
9594879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 19 - 162
Target Start/End: Original strand, 9594334 - 9594477
Alignment:
| Q |
19 |
aaagtcttactaaaaattgttttggtcagctgataattgtttcatccataaattaaatttggattctcctaagcaattcattcttagaagaaatttatta |
118 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||| ||||||||| ||| ||||||||||||||||| |
|
|
| T |
9594334 |
aaagtcttactaaaaattgttttgatcagctgataattgttttatccataaatcaaatttggattctcttaagcaatttatttttagaagaaatttatta |
9594433 |
T |
|
| Q |
119 |
atcactcgacctcaattatttggttgaaatattcattttcagta |
162 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9594434 |
atcactcaacctcaattatttggttgaaatattcattttcagta |
9594477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 256 - 353
Target Start/End: Original strand, 18714896 - 18714993
Alignment:
| Q |
256 |
tggttgcggtgaatcagaaaccgtagcccatttattttttggttgcaacattctcagtttgctttggactcatgtgttacactggttgagtctctctg |
353 |
Q |
| |
|
||||||||||||| ||||||||| | |||||||||||||||||||||||| | | |||||||||||| | ||||||||||| ||| || |||| |||| |
|
|
| T |
18714896 |
tggttgcggtgaaccagaaaccgcatcccatttattttttggttgcaacacttttagtttgctttggtcccatgtgttacattggatgggtctttctg |
18714993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University