View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21444_high_28 (Length: 308)
Name: NF21444_high_28
Description: NF21444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21444_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 1 - 195
Target Start/End: Complemental strand, 20623227 - 20623033
Alignment:
| Q |
1 |
tggtttccaaatacactagcccaaggtatgcccctatttcttgctggagaggttgcttgatcccaatacaaacttgcatttccaatcattatattgttag |
100 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20623227 |
tggtttccgaatacactagcccaaggaatgcctcgatttcttgctggagaggttgcttgatcccaatacaaacttgcattttcaatcattatattgttag |
20623128 |
T |
 |
| Q |
101 |
cagtaatgacatcaccaagatatattacaaaatctgtcatacagttaaactgattattatttggcattcgtggacatcgaaaaacataccactag |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| | ||||| |||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
20623127 |
cagtaatgacatcaccaagatatattacaaaatctgtcatatagttaaccagattagtatttggcattcgtagacattgaaaatcataccactag |
20623033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University