View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21445_high_13 (Length: 250)
Name: NF21445_high_13
Description: NF21445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21445_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 47581676 - 47581437
Alignment:
| Q |
1 |
gaaagttgcaagtaaaaacagcaaatggaaggaagccattcttcacaaggggggctaggaactcataatatgatatgacaagcatagtgagttagtgacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47581676 |
gaaagttgcaagtaaaaacagcaaatggaaggaagccattcttcacaaggggggctaggaactcataatatgatatgacaagcatagtgagttagtgacg |
47581577 |
T |
|
| Q |
101 |
ttggtagtcgttgatatatatgttttcttttgtgaactttaaagatttagtttaatgatcctatgacaaagatttggttaaatgataattaatgtaatag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47581576 |
ttggtagtcgttgatatatatgttttcttttgtgaactttaaagatttagtttaatgatcctatgacaaagatttggttaaataataattaatgtaatag |
47581477 |
T |
|
| Q |
201 |
ttatgattatatagcccaacccactaagt-atttattcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47581476 |
ttatgattatatagcccaacccactaagtaatttattcat |
47581437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University