View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21445_high_15 (Length: 236)
Name: NF21445_high_15
Description: NF21445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21445_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 41734158 - 41734293
Alignment:
| Q |
1 |
atatatgtaggaatcaggttttgaacctcgaacatcccacttatttgttttaaaaaggtaaattgtttatagctagactaaattcgaccaaaaaattcac |
100 |
Q |
| |
|
|||||| |||||||| |||||||||||||| ||| ||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41734158 |
atatatataggaatcgggttttgaacctcggacaccccacttatttgttttaaaaaagtaaattgtttataactagactaaattcgaccaaaaaattcac |
41734257 |
T |
 |
| Q |
101 |
ctaatgatnnnnnnnncggatagttgcaaacataattt |
138 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
41734258 |
ctaatgat--aaaaaacggatagttgcaaacataattt |
41734293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 137 - 214
Target Start/End: Original strand, 41734937 - 41735014
Alignment:
| Q |
137 |
ttcatccacgtctgcccctccctaaattcgtcgcagacaatgatgtcatatatctccctttttatatcactttcaatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41734937 |
ttcatccacgtctgcccctccctaaattcgtcgcagacaatgatgtcatatatctccctttttatatcactttcaatg |
41735014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University