View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21445_high_16 (Length: 235)
Name: NF21445_high_16
Description: NF21445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21445_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 221
Target Start/End: Complemental strand, 15158414 - 15158200
Alignment:
| Q |
7 |
tgagatgaacaagattcacatatctttgacaattgtttcctcttttacttccctctctattagatcgtattattccttcttgctcaatgatggtttaaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15158414 |
tgagatgaacaagattcacatatctttgacaattgtttcctcttttacttccctctctattagatcgtattattccttcttgctcaatgatggtttaaaa |
15158315 |
T |
|
| Q |
107 |
gtggaatgaagaaatttttataatcataaaaatcgtagtgtatgagctatccttgtttggagttggaccctaacccaaaaggtgctaatcaattcaatcc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15158314 |
gtggaatgaagaaatttttataatcataaaaatcgtagtgaatgagttatccttgtttggagttggaccctaacccaaaaggtgctaatcaattcaatcc |
15158215 |
T |
|
| Q |
207 |
atattctaaatattg |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
15158214 |
atattctaaatattg |
15158200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University