View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21445_high_5 (Length: 393)
Name: NF21445_high_5
Description: NF21445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21445_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 290; Significance: 1e-162; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 20 - 381
Target Start/End: Complemental strand, 39789877 - 39789519
Alignment:
| Q |
20 |
caagtgcaacatgacactttttatcaatagaaattgaactaaatatgatcatacttgcacatcaatctcttgtgttagacctcaacgctgatttgattac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
39789877 |
caagtgcaacatgacactttttatcaatagaaattgaactaaatatgatcatacttgcatatcaatctcttgcattagacctcaacgctgatttaattac |
39789778 |
T |
 |
| Q |
120 |
agcaaacgacttttttatattagaaattgtgtgtcgcgtgatttacattggctacacacactgcgcaccaatcacttgccctagatcagagtgataaatg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39789777 |
agcaaacgacttttttatattagaaattgtgtgtcgcatgatttacaatggctac--acactgcgcaccaatcacttgccctagatcagagtgataaatg |
39789680 |
T |
 |
| Q |
220 |
ccacaagggactttgacattgcattttttactcaatattgtaaggcattgcacatttaagttatatcttttatttaactcatttataatgggtgtgacat |
319 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39789679 |
ccacaagggactttgacattgca-tttttactcaatattgtaaggcattgcacatttaagttatatcttttatttaactcatttataatgggtgtgacat |
39789581 |
T |
 |
| Q |
320 |
tacctaagnnnnnnntgtcacattgaaattggttaacttacgtagctgcatatttcttctct |
381 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39789580 |
tacctaagaaaaatatgtcacgttgaaattggttaacttacgtagctgcatatttcctctct |
39789519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University