View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21445_low_9 (Length: 335)
Name: NF21445_low_9
Description: NF21445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21445_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 147 - 321
Target Start/End: Original strand, 12151415 - 12151588
Alignment:
| Q |
147 |
ataaacaaagaaattaacaacgaaaaagttgactaaatgattctctaatacaattagaaaagaaaattatacttgtttaacaagctttatgcataataaa |
246 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
12151415 |
ataagcaaagaaattaacaacgaaaaagttgactaaatgattctctaatacaattagaaaagaaaattatacttatttaacaagctttatgcataat-aa |
12151513 |
T |
 |
| Q |
247 |
tatgtagatcagaccaacttagtatgaataatttctctaataatcaaatcatttttcagatcatgatgaactttt |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12151514 |
tatgtagatcagaccaacttagtatgaataatttctctaataatcaaatcatttttcagatcatgatgaactttt |
12151588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 12144141 - 12144225
Alignment:
| Q |
1 |
accttcttgcacagtactcttgtgctcctgtgcactgtaactaaggatcacataaggatctatgctagctgctcatacagaacaa |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12144141 |
accttcttgcacagtactcttgtgctcctgtgccctgtaagtgaggatcacataaggatctatgctagctgctcattcagaacaa |
12144225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 12151341 - 12151417
Alignment:
| Q |
1 |
accttcttgcacagtactcttgtgctcctgtgcactgtaactaaggatcacataaggatctatgctagctgctcata |
77 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12151341 |
accttcttgaacagtactcttgtgctcctgtccactgtaactaaggatcacataaggatctatgctagctgctcata |
12151417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University