View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21446_low_1 (Length: 325)
Name: NF21446_low_1
Description: NF21446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21446_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 117 - 309
Target Start/End: Complemental strand, 43142752 - 43142557
Alignment:
| Q |
117 |
ttacacaattgaacgcactttgtttgagaacactaattgatggtattagtacgtagcatggttttgttctctttgccactcctctcttt---ctatgatt |
213 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
43142752 |
ttacacaattgaacgcaatttgtttgagaacactaattgatggtattagtacatagcatggttttgttctctttgccactcctctctttattctatggtt |
43142653 |
T |
 |
| Q |
214 |
gtccccttttaactcacttcaaccatcattgttaatgttcgcacattctcttatgaaccacgtattttcataagagaatgtaagagcaaaaacaag |
309 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43142652 |
gtccccttttaactcatttcaaccatcattgttaatgttcacacattctcttatgaaccacttattttcataagagaatgtaagagcaaaaacaag |
43142557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 92
Target Start/End: Complemental strand, 43142794 - 43142744
Alignment:
| Q |
42 |
gtatagaacaaggacctcatgaacaaaattacgtggattaaattgcacaat |
92 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43142794 |
gtatagaacaagaacctcatgaacaaaattacgtggattaaattacacaat |
43142744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University