View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21447_low_17 (Length: 218)
Name: NF21447_low_17
Description: NF21447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21447_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 30 - 203
Target Start/End: Original strand, 23890050 - 23890223
Alignment:
| Q |
30 |
ggattacacgatgttttacacatccgatccttttatgaccttttccccttcttcatctacctttcctattatctgtgtcatctctttctcttcaacttca |
129 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
23890050 |
ggattacaggatgttttacacatccgatccttttatgaccttttccccttcttcatctacctttcctattatccatgccttctctttctcttcaacttca |
23890149 |
T |
|
| Q |
130 |
atccatttttactttaatgtcccattttcctttctcttaattctattcatctctttcccctttcttcatcattc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23890150 |
atccatttttactttaatgtcccattttcctttctcttaattctattcatctctttcccctttcttcatcattc |
23890223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 30 - 96
Target Start/End: Original strand, 28021635 - 28021701
Alignment:
| Q |
30 |
ggattacacgatgttttacacatccgatccttttatgaccttttccccttcttcatctacctttcct |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28021635 |
ggattacacgatgttttacacatccgatccttttatgaccttttccccttcttcatctaccgttcct |
28021701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 30 - 96
Target Start/End: Original strand, 43720209 - 43720275
Alignment:
| Q |
30 |
ggattacacgatgttttacacatccgatccttttatgaccttttccccttcttcatctacctttcct |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43720209 |
ggattacacgatgttttacacatccgatccttttatgaccttttccccttcttcatctacctttcct |
43720275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University