View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21447_low_6 (Length: 297)
Name: NF21447_low_6
Description: NF21447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21447_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 17 - 289
Target Start/End: Original strand, 31104155 - 31104427
Alignment:
| Q |
17 |
agttttacccctcattttcttcaagttatcacgatgatttaaacggctttgccttgccgcatgtggcaaaggaatgtatggcttaacaacagatctccca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31104155 |
agttttacccctcattttcttcaagttatcacgatgatttaaacggctttgccttgccgcatgtggcaaaggaatgtatggcttaacaacagatctccca |
31104254 |
T |
 |
| Q |
117 |
ggcgattttaattggatagatctaaagccattctgttctaacttccaaagcttaccacaacaactacatggcctagatcccttaggtctggaaaacaaat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31104255 |
tgcgattttaattggatagatctaaagccattctgttctaacttccaaagcttaccacaacaactacatggcctagatcccttaggtctggaaaacaaat |
31104354 |
T |
 |
| Q |
217 |
ctcggctcaacggagtattttgatagccagaaccaccgataacaacaccaaatttacccgacaacaacctatg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31104355 |
ctcggctcaacggagtattttgatagccagaaccaccgataacaacaccaaatttacccgacaacaacctatg |
31104427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University