View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21448_high_10 (Length: 244)
Name: NF21448_high_10
Description: NF21448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21448_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 14 - 228
Target Start/End: Complemental strand, 11520705 - 11520491
Alignment:
| Q |
14 |
aatatatgaataagcagatatatgcatattttgtaaggactttaagcaaattgggccattcctctgaagcacataggctattttgcaacatgtggaacgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11520705 |
aatatatgaataagcagatatatgcatattttgtaaggactttaagcaaattgggccattcctctgaagcacataggctattttgcaacatgtggaacgt |
11520606 |
T |
|
| Q |
114 |
tcatgacaagggtgataaagatgcctacatgtccatgttggagagtttatgcagtagtggtaaaatagctgaagcaatagatcttctgaatagatttcat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11520605 |
tcatgacaagggtgataaagatgcctacatgtccatgttggagagtttatgcagtagtggtaaaatagctgaagcaatagatcttctgaatagatttcat |
11520506 |
T |
|
| Q |
214 |
gaaaagtgtataact |
228 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
11520505 |
gaaaagtgtataact |
11520491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University