View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21448_high_6 (Length: 377)
Name: NF21448_high_6
Description: NF21448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21448_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 36 - 367
Target Start/End: Complemental strand, 38618976 - 38618645
Alignment:
| Q |
36 |
catgaatgacagacagacacaagtcgagagtgccatcttttgtgcagccttcaattacatgaattttttatgctatttcttgtactaatgttgttgcctg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38618976 |
catgaatgacagacagacacaagtcgagagtgccatcttttgtgcagccttcaattacatgaattttttatgctatttcttgtactaatgttgttgcctg |
38618877 |
T |
 |
| Q |
136 |
ttgggatacaaaaatgcatacgaacggaattgaaccagtcacactcacacgaattgctgaccatacatgggtggtttgaagatgaaatgtgtaaatggct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38618876 |
ttgggatacaaaaatgcatacgaacggaattgaaccagtcacactcacacgaattgctaaccatacatgggtggtttgaagatgaaatgtgtaaatggct |
38618777 |
T |
 |
| Q |
236 |
tatagctagtcatggctgcgccattggtctttgtactagtatcatatccagcattattcattttagtattgttgctttctcctatatgacatttgtagaa |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38618776 |
tatagctagtcatggctgcgccattggtctttgtactagtatcttatccagcattattcattttagaattgttgctttctcctatatgacatttgtagaa |
38618677 |
T |
 |
| Q |
336 |
atatttttccttaaaccttatctttgcctttg |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38618676 |
atatttttccttaaaccttatctttgcctttg |
38618645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University