View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21448_low_12 (Length: 236)
Name: NF21448_low_12
Description: NF21448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21448_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 26879336 - 26879555
Alignment:
| Q |
1 |
atcttcaggtgagaattagaaagaacttgcacaaactctgcacattaaatcacaagacacaatatgagtgaggaattttaacaggatctcagtgatgatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26879336 |
atcttcaggtgagaattagaaagaacttgcacaaactctgcacattaaatcacaagacacaataagagtgaggaattttaacaggatcacagtgatgatc |
26879435 |
T |
|
| Q |
101 |
cgcgcacatatcagttaggccatttggctctagttcaaggaattaggatagtaggggttgtaaatctggaagacagtatccagagggaatgaataacaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
26879436 |
cgcgcacatatcagttaggccatttggctctagttcaaggaattagaatagtaggggttgtaaatctggtagacagtatccagggggaatgaataacaca |
26879535 |
T |
|
| Q |
201 |
tcaaacctagaggaaaaatt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26879536 |
tcaaacctagaggaaaaatt |
26879555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 40248818 - 40248893
Alignment:
| Q |
1 |
atcttcaggtgagaattagaaagaacttgcacaaactctgcacattaaatcacaagacacaatatgagtgaggaat |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| || ||||||||||| |
|
|
| T |
40248818 |
atcttcaggtgagaattagaaagaacttgcacaaactctgcacgttaaatcacaagaaacagtaagagtgaggaat |
40248893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University