View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21448_low_13 (Length: 235)
Name: NF21448_low_13
Description: NF21448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21448_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 2948463 - 2948364
Alignment:
| Q |
18 |
gtccatggccctttctttaaaccaaccttttcacaacatggtgatctccccattggaaatgttctaatgaaaaactatatagtaaattttgtatatggtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2948463 |
gtccatggccctttctttaaaccaaccttttcacaacatggtgatctccccattggaaatgttctaatgaaaaactatatagtaaattgtgtatatggtt |
2948364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 165 - 218
Target Start/End: Complemental strand, 2948316 - 2948263
Alignment:
| Q |
165 |
tatataagttgatcaagtagctatgtacaagaaattaatgagatgggcagagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2948316 |
tatataagttgatcaagtagctatgtacaagaaattaatgagatgggcagagaa |
2948263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 61
Target Start/End: Complemental strand, 3910329 - 3910285
Alignment:
| Q |
17 |
agtccatggccctttctttaaaccaaccttttcacaacatggtga |
61 |
Q |
| |
|
||||||||| ||||||||||||||||| || |||||||||||||| |
|
|
| T |
3910329 |
agtccatggacctttctttaaaccaactttgtcacaacatggtga |
3910285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University