View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21448_low_7 (Length: 375)
Name: NF21448_low_7
Description: NF21448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21448_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 270; Significance: 1e-151; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 20 - 361
Target Start/End: Complemental strand, 9937125 - 9936793
Alignment:
| Q |
20 |
tagccgttgatgccgatcttcttattggctgtggatgtggaccgttgattccgctgaatctaacttccgaatttgaccttgaaattgatgcagctgccat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9937125 |
tagccgttgatgccgatcttcttattggctgtggatgtggaccgttgattccgctgaatctaacttctgaatttgaccttgaaattgatgcagctgccat |
9937026 |
T |
|
| Q |
120 |
ttcaaatgcttctggtgcatttgcatccaccggatctacaacttcttcttgaatcggaatctgttcaggaacaggttccggttcaaccttaggttcttgt |
219 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9937025 |
ttcaaatgcttctggtgggtttgcatccatcggatctacaacttcttcttgaaccggaatctgttcaggaacaggttccggttcaaccttaggttcttgt |
9936926 |
T |
|
| Q |
220 |
tcacctttagccttaggctggggcccagcttcggatggcggaggtggtgctccgaacggttgatcagacggtgatgccggtggtggttcaactttttccg |
319 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9936925 |
tcaccttcagccttaggttggggcccagcttcggatggcggaggtggtgctccggacggttgatcagac---------ggtggtggttcaactttttcca |
9936835 |
T |
|
| Q |
320 |
gctcagatggcggtggtggcgattcttctacttttccggatg |
361 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9936834 |
gctcagatggcggtggaggcgattcttctacttttccggatg |
9936793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 292 - 359
Target Start/End: Complemental strand, 9967028 - 9966961
Alignment:
| Q |
292 |
gatgccggtggtggttcaactttttccggctcagatggcggtggtggcgattcttctacttttccgga |
359 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9967028 |
gatggcggtggtggttcaactttttccggctcagatggcggtggtggcgattcttctacttttacgga |
9966961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 154 - 267
Target Start/End: Complemental strand, 9967129 - 9967014
Alignment:
| Q |
154 |
tctacaacttcttcttgaatcggaatctgttcaggaacaggttccggttcaaccttaggttcttgttcac--ctttagccttaggctggggcccagcttc |
251 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||| |||||||||||| || |||||||||||||||||||| ||| ||||||||| ||||| |||||||| |
|
|
| T |
9967129 |
tctacaacttcttcctgaaccggaacttgttcaagaacaggttccgttttaaccttaggttcttgttcacctcttcagccttaggttggggtccagcttc |
9967030 |
T |
|
| Q |
252 |
ggatggcggaggtggt |
267 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
9967029 |
agatggcggtggtggt |
9967014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University