View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2144_high_5 (Length: 247)
Name: NF2144_high_5
Description: NF2144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2144_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 2 - 230
Target Start/End: Complemental strand, 9720962 - 9720736
Alignment:
| Q |
2 |
gaaaagaatgtttaattgttgtggtactgtattgagacgtgggtattttgaggccattcatgtctaagaaggagtattgatgacgtgtgtttgaatttta |
101 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | || || |||||||||||||||||| |
|
|
| T |
9720962 |
gaaaagaatgtataattgttgtggtactgtattgagacgtggatattttgaggccattcatgtctaagaaggggaat--atcacgtgtgtttgaatttta |
9720865 |
T |
 |
| Q |
102 |
acattgacttggaactgcatggaccttagaatccaagcatccatgtcactgctgaaaggagacaatggcgtaaggacacctttaatggtgcaactcaaca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9720864 |
acattgacttggaactgcatggaccttagaatccaagcatccatgtcactgctgaaaggagacaatggtgtaaggacacctttaatggtgcaactcaaca |
9720765 |
T |
 |
| Q |
202 |
agactacaagagtattgtcatgctcccct |
230 |
Q |
| |
|
||||||||| ||||||||||||||||||| |
|
|
| T |
9720764 |
agactacaatagtattgtcatgctcccct |
9720736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University