View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2144_high_6 (Length: 246)
Name: NF2144_high_6
Description: NF2144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2144_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 34870217 - 34870335
Alignment:
| Q |
1 |
tttttaactttctattattagtctatttatcaacaactaactcaataacttatgtagtaacattcaaattcaaacgagttaagctaaatagataaaacaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34870217 |
ttttaaactttctattattagtctatttatcaacaact----caataacttatgtattaacattcaaattcaaacgagttaagctaaatagataaaacaa |
34870312 |
T |
|
| Q |
101 |
aactacaataattgtatgatcta |
123 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
34870313 |
aactacaataattgcatgatcta |
34870335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 116 - 228
Target Start/End: Original strand, 34870385 - 34870504
Alignment:
| Q |
116 |
atgatctaggggcattttcatcatttcgtaattagtggatttaaattgttgactc-------tttttggattatatatttagttatttatcagcattttc |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||| || | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34870385 |
atgatttaggggcattttcatcatttcgtaattagtgggtttaaattgttaacacctcattgtttttggattatatatttagttatttatcagcattttc |
34870484 |
T |
|
| Q |
209 |
tccattttagtgggtttatt |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34870485 |
tccattttagtgggtttatt |
34870504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University