View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2144_low_4 (Length: 359)
Name: NF2144_low_4
Description: NF2144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2144_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 1 - 342
Target Start/End: Complemental strand, 18513978 - 18513635
Alignment:
| Q |
1 |
ttctttcacagcttgtacgtgcctaattttatctgactatgctattatcatcttgcactcgtatgctatatcctattttctctctatgatatcatgtaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18513978 |
ttctttcacagcttgtacgtgcctaattttatctgactatgctattatcatcttgcactcgtatgctatatcctattttctctctatgatatcatgtaca |
18513879 |
T |
|
| Q |
101 |
attcattttcaactttgtatcactttaaaatattaaagaaaaaagaggatataaaaataatttgcaccagaactacataatatgttacggcctgtagaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18513878 |
attcattttcaactttgtatcactttaaaatattaaagaaaaaagaggatataaaaataatttgcaccagaactacataatatgttacggcctgtagaaa |
18513779 |
T |
|
| Q |
201 |
actgatgcagccattgcacctactaggatgaaatgttgttatggaatttttgctgtgatttactttcacatggcaattgtgaccgcatgttgcagacaac |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18513778 |
actgatgcagccattgcacctactaggatgaaatgttgttatggaatttttgctgtgatttactttcacatggcagttgtgaccgcatgttgcagacaac |
18513679 |
T |
|
| Q |
301 |
tacatgcaactgtaatatt--gcggccgcgtcatgtgcagttag |
342 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18513678 |
tacatgcaactgtaatattgcgcggccgcgtcatgtgcagttag |
18513635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University