View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2144_low_5 (Length: 254)
Name: NF2144_low_5
Description: NF2144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2144_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 241
Target Start/End: Complemental strand, 33486714 - 33486492
Alignment:
| Q |
17 |
taagaaagtagctttggtgagtgtacaataatgccaaagaaaatgcttatatggctggcgttttaacttttagttatatatagaagcagcaacttttaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33486714 |
taagaaagtagctttggtgagtgtacaataatgccaaagaaaatgcttatatggctggcgttttaacttttagttatatatagaagcagcaacttttaat |
33486615 |
T |
|
| Q |
117 |
gagtagagtagcactatatttgtaacacgtacagagtatagagacccccactgagtcacactgactgattaagaaggaagnnnnnnnnggatatttggca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||||| ||||| |||||||||||| |
|
|
| T |
33486614 |
gagtagagtagcactatatttgtaacacgtacagagtatagagaccaccactgagt--cactgactgcttaagagggaaggtttttttggatatttggca |
33486517 |
T |
|
| Q |
217 |
acttttctaatgctttggtttcttc |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33486516 |
acttttctaatgctttggtttcttc |
33486492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University