View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21450_high_2 (Length: 238)
Name: NF21450_high_2
Description: NF21450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21450_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 37191121 - 37190909
Alignment:
| Q |
1 |
caatcagtctcacaaagctcaagttggtagataagttaatcaaaagatgtctgatattaaggattaaattgacttatcgaaaagggccttacctcggtaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37191121 |
caatcagtctcacaaagctcaagtta--aaataagttaatcaaaacatgtctgatattaaggattaaattgacttatcgaaaagggccttacctcggtaa |
37191024 |
T |
|
| Q |
101 |
tctgaagaacaacgtcgtctctacggagaaacttcccaagcaaacgaggggcaaggtctagtgcgtcgatttgaaagaactcgcgaggcaaagtttttgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37191023 |
tctgaagaacaacgtcgtctctacggagaaacttcccaagcaaacgaggggcaaggtctagtgcgtcgatttgaaagaactcgcgaggcaaaggttttgt |
37190924 |
T |
|
| Q |
201 |
attttcgaatgaaat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37190923 |
attttcgaatgaaat |
37190909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 137 - 220
Target Start/End: Original strand, 13419365 - 13419447
Alignment:
| Q |
137 |
caagcaaacgaggggcaaggtctagtgcgtcgatttgaaagaactcgcgaggcaaagtttttgcattttcgaatgaaatctgtg |
220 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||| |||||||| ||||||| ||||| |||||||||||||| |||| |
|
|
| T |
13419365 |
caagcaaacgaggggcaaggtctggtgcatcgatttgaaataactcgcgtggcaaag-ttttgttttttcgaatgaaatgtgtg |
13419447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University