View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21450_low_1 (Length: 297)
Name: NF21450_low_1
Description: NF21450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21450_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 108 - 280
Target Start/End: Complemental strand, 13141151 - 13140979
Alignment:
| Q |
108 |
cctaacgtttttggatcttgattgggtagaagatttgggttttggggtggtggggttgctgttttcatggaggagaaggagtctcgatgatcttcgtggg |
207 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13141151 |
cctaacggttttggatcttgattgggtagaagatttgggttttggggtggtagggttgctgttttcatggaggagaaggagtctcgatgatcttcgtggg |
13141052 |
T |
|
| Q |
208 |
gtgccaggtgggtacacgacggtgggttttctgtttcccattttcacaaacagttggtgggtggggacgattg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13141051 |
gtgccaggtgggtacacgacggtgggttttctgtttcccattttcacaaacagttggtgggtggggacgattg |
13140979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 17 - 78
Target Start/End: Complemental strand, 13141215 - 13141154
Alignment:
| Q |
17 |
aagaaccaaattcactcactttaacatcatttttcttcaagaatctaggagatcgtctaagc |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13141215 |
aagaaccaaattcactcactttaacatcatttttcttcaagaatctaggagatcgtctaagc |
13141154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 29013699 - 29013966
Alignment:
| Q |
19 |
gaaccaaattcactcactttaacatcatttttcttcaagaatctaggagatcgtctaagcgactgaacttcatcattaaacttgagt---------accc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||| | ||| ||||||||| | || ||| || |||| |
|
|
| T |
29013699 |
gaaccaaattcactcactttaacatcatttttgttggagaatctaggagatcgtctacgtgacggaacttcatggctcaaattgggtgattttcttaccc |
29013798 |
T |
|
| Q |
110 |
taacgtttttggatcttgattgggtagaagatttg------------ggttttggggtggtggggttgctgttttcatggaggagaaggagtctcgatga |
197 |
Q |
| |
|
||||| ||||||||||||| ||||| ||||||||| ||||||||||| ||||||||| |||||||||||||||| | |||||||| ||| |
|
|
| T |
29013799 |
taacggttttggatcttgactgggttgaagatttgttagtggaattgggttttggggttgtggggttgttgttttcatggaggaggacgagtctcggtga |
29013898 |
T |
|
| Q |
198 |
tcttcgtggggtgccaggtgggtacacgacggtgggttttctgtttcccattttcacaaacagttggt |
265 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||| ||||| |
|
|
| T |
29013899 |
tcttcgtggggcgccaggtgggtacacgacggtggggtttctgtttggcattttcacaaacacttggt |
29013966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University