View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21451_high_13 (Length: 239)
Name: NF21451_high_13
Description: NF21451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21451_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 2 - 220
Target Start/End: Complemental strand, 44965258 - 44965040
Alignment:
| Q |
2 |
aactcggtgctgatcttagaagtgaaatgggtgattgaggtttagaaatgggttcaattggaagcacttttctttttgagattggttcgtttggagacat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965258 |
aactcggtgctgatcttagaagtgaaatgggtgattgaggtttagaaatgggttcaattggaagcacttttctttttgagattggttcgtttggagacat |
44965159 |
T |
|
| Q |
102 |
aggaagtgttgttttttgaggaacattagtttcagttttggttttgacatgttggtcgtcgctcatggtaagttctaagtcgaagaatgagtcatcttcg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965158 |
aggaagtgttgttttttgaggaacattattttcagttttggttttgacatgttggtcgtcgctcatggtaagttctaagtcgaagaatgagtcatcttcg |
44965059 |
T |
|
| Q |
202 |
tctgattcactgtctgttt |
220 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44965058 |
tctgattcactgtctgttt |
44965040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University