View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21451_high_5 (Length: 389)
Name: NF21451_high_5
Description: NF21451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21451_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 18 - 378
Target Start/End: Original strand, 6101464 - 6101824
Alignment:
| Q |
18 |
caaatcccctaatcctctctacaccaccgccgaacacgccgcacatcgttccgccgaatccatcaaccgaatcttccaccacgtaaaacgaacaagcctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6101464 |
caaatcccctaatcctctctacaccaccgccgaacacgccgcacatcgttccgccgaatccatcaaccgaatcttccaccacgtaaaacgaacaagcctc |
6101563 |
T |
|
| Q |
118 |
gccgccactgttttatggcagtcgctaaggtcggtgttatcttccgcgaaccacgaggttcggtctggattcgagattcgtgtggcggcgttgctggcag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6101564 |
gccgccactgttttatggcagtcgctaaggtcggtgttatcttccgcgaaccacgaggttcggtctggattcgagattcgcgtggcggcgttgctggcag |
6101663 |
T |
|
| Q |
218 |
atatttctgcggcgaattcgagccggagagcggcgattgtgggtgctggtggcggtgcggttgtggattggttgcttgattctgttgcggttgtgaagga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6101664 |
atatttctgcggcgaattcgagccggagagcggcgattgtgggtgctggtggcggtgcggttgtggattggttgcttgattctgttgcggttgtgaagga |
6101763 |
T |
|
| Q |
318 |
tgctggtggtggtactcaggcggaggcggcgagagcattggcgtatttgatttcggatcct |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6101764 |
tgctggtggtggtactcaggcggaggcggcgagagcattggcgtatttgatttcggatcct |
6101824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University