View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21451_low_17 (Length: 204)
Name: NF21451_low_17
Description: NF21451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21451_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 19 - 180
Target Start/End: Complemental strand, 2945273 - 2945119
Alignment:
| Q |
19 |
atattttatgatttactttggtgcctaagagaggaactgtagagcatggataaatttttggatagtattaccattttcatgctcattctcattaatcata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||| ||||| ||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
2945273 |
atattttatgatttactttggtgcctaagagaggaaccgtagagtatggataaacttttgcatagtattaccattttcatgctcattctcattaataaca |
2945174 |
T |
|
| Q |
119 |
ttttatgcaagttactattaacattgtcattttcacgctttagacaagtaaagttgtcactt |
180 |
Q |
| |
|
||||| ||||| |||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
2945173 |
ttttaagcaag-------taacattgtcattttcactctttagacaagtaaagatgtcactt |
2945119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 20 - 121
Target Start/End: Complemental strand, 2964599 - 2964490
Alignment:
| Q |
20 |
tattttatgatttactttggtgcctaagagaggaactgtagagcatggataaatttttggatagtatta--ccattt------tcatgctcattctcatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
2964599 |
tattttatgatttactttggtgcctaagagaggaacggtagagtatggataaatttttggatagtattaccccattttcatggtcatgctcattctcatt |
2964500 |
T |
|
| Q |
112 |
aatcatattt |
121 |
Q |
| |
|
|||||||||| |
|
|
| T |
2964499 |
aatcatattt |
2964490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 149 - 183
Target Start/End: Complemental strand, 2964492 - 2964458
Alignment:
| Q |
149 |
tttcacgctttagacaagtaaagttgtcacttcat |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2964492 |
tttcacgctttagacaagtaaagttgtcacttcat |
2964458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University