View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21451_low_4 (Length: 440)
Name: NF21451_low_4
Description: NF21451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21451_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 227 - 420
Target Start/End: Complemental strand, 10126724 - 10126531
Alignment:
| Q |
227 |
attactcatacccgggttgtcagtcaccctcactccatgatccttctaaagggagtaaattcgattcactttcttcttggaagttatgagagcatgnnnn |
326 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
10126724 |
attacacatacccgggttgtcagtcaccctcactccatgatccttctaaagggagtaaattcgattcactttcttcttggaagtcatcggagcatgaaaa |
10126625 |
T |
|
| Q |
327 |
nnntctagtgttcaggtcaccgtctcgataccaataggttttggcatgttgcctccaatacaaatcttcttgcaccatgagttgcgtttagtgt |
420 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10126624 |
aaatctagtgttcagttcaccgtctctataccaataggttttggcatgttgcctccaatacaaatcttcttgcaccatgagttgcgtttagtgt |
10126531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 216 - 276
Target Start/End: Complemental strand, 10126784 - 10126724
Alignment:
| Q |
216 |
ttttgagcagtattactcatacccgggttgtcagtcaccctcactccatgatccttctaaa |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10126784 |
ttttgagcagtattactcatacccgggttgtcagtcaccctcactccatgatcattctaaa |
10126724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University