View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21452_high_5 (Length: 250)

Name: NF21452_high_5
Description: NF21452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21452_high_5
NF21452_high_5
[»] chr4 (2 HSPs)
chr4 (4-217)||(21513291-21513504)
chr4 (133-191)||(6825034-6825092)
[»] chr8 (1 HSPs)
chr8 (4-191)||(26947504-26947691)
[»] scaffold0373 (1 HSPs)
scaffold0373 (133-191)||(15181-15239)
[»] chr1 (1 HSPs)
chr1 (181-213)||(8989466-8989498)


Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 4 - 217
Target Start/End: Complemental strand, 21513504 - 21513291
Alignment:
4 tgtgccaaaggcaatggaggaaaagaactaacactatgaaaatctttgaatgggcataagaaaaatcttcgagcatggtacacaagaattgatcggcatt 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
21513504 tgtgccaaaggcaatggaggaaaagaactaacactatgaaaatctctgaatgggcataagaaaaatcttcgagcatggtacacaagaattgattggcatt 21513405  T
104 tcatcaatcgaggattcgggtagagcaagatttgagctaccacgaactatgcttggagttatcaaaatttgtatcaaggaggagtgttgaaaaatgctac 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21513404 tcatcaatcgaggattcgggtagagcaagatttgagctaccacgaactatgcttggagttatcaaaatttgtatcaaggaggagtgttgaaaaatgctac 21513305  T
204 aaatttctagtaga 217  Q
    ||||||||||||||    
21513304 aaatttctagtaga 21513291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 191
Target Start/End: Original strand, 6825034 - 6825092
Alignment:
133 atttgagctaccacgaactatgcttggagttatcaaaatttgtatcaaggaggagtgtt 191  Q
    ||||||||||| ||||||||||||||||||||   |||| || ||||||||||||||||    
6825034 atttgagctactacgaactatgcttggagttactgaaatatgcatcaaggaggagtgtt 6825092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 4 - 191
Target Start/End: Complemental strand, 26947691 - 26947504
Alignment:
4 tgtgccaaaggcaatggaggaaaagaactaacactatgaaaatctttgaatgggcataagaaaaatcttcgagcatggtacacaagaattgatcggcatt 103  Q
    |||||||||||||||||||||||||| | || |||| |||||||||||||||||||||| ||| ||| ||||||||||||||||||||||||||  ||||    
26947691 tgtgccaaaggcaatggaggaaaagatccaagactaagaaaatctttgaatgggcataataaacatcctcgagcatggtacacaagaattgatcaacatt 26947592  T
104 tcatcaatcgaggattcgggtagagcaagatttgagctaccacgaactatgcttggagttatcaaaatttgtatcaaggaggagtgtt 191  Q
    | |||||||||||||| || |||| ||||||||||||||| ||||| |||||||||||||| | |||| || ||||||||||||||||    
26947591 ttatcaatcgaggatttggctagatcaagatttgagctactacgaattatgcttggagttaccgaaatatgcatcaaggaggagtgtt 26947504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0373 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0373
Description:

Target: scaffold0373; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 191
Target Start/End: Complemental strand, 15239 - 15181
Alignment:
133 atttgagctaccacgaactatgcttggagttatcaaaatttgtatcaaggaggagtgtt 191  Q
    ||||||||||| ||||||||||||||||||||   |||| || ||||||||||||||||    
15239 atttgagctactacgaactatgcttggagttactgaaatatgcatcaaggaggagtgtt 15181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 181 - 213
Target Start/End: Original strand, 8989466 - 8989498
Alignment:
181 ggaggagtgttgaaaaatgctacaaatttctag 213  Q
    ||||||||||||||| |||||||||||||||||    
8989466 ggaggagtgttgaaatatgctacaaatttctag 8989498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University