View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21452_low_3 (Length: 317)
Name: NF21452_low_3
Description: NF21452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21452_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 110 - 295
Target Start/End: Complemental strand, 20844306 - 20844128
Alignment:
| Q |
110 |
ttgtaggaatcgtagataaaataaccttatgcacgttacattcataatttttcattctcctaactatatgcaacatgtagataggtggttgtggnnnnnn |
209 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20844306 |
ttgtaggaatcgtgaataaaataaccttatgcacgttacattcataatttttcattcacctaactatatgcaacatgtagataggtggttgtgg------ |
20844213 |
T |
|
| Q |
210 |
nnnnnnnncaagatctttgaaagaatttagtagcgttataactgaaactttgaagttcctctacctttgctagccaaccattacct |
295 |
Q |
| |
|
| |||| |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
20844212 |
aatgaaaactagatttttgaaagaatttagtagcgttataactgaaactttgaagtt-ctccacctttgctagccaaccattacct |
20844128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 59 - 109
Target Start/End: Complemental strand, 20844388 - 20844337
Alignment:
| Q |
59 |
agtccaaac-ttttgtccaactctagaaaagcaagacaattatgcatgtggt |
109 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20844388 |
agtccaaaccttttgtccaactttagaaaagcaagacaattatgcatgtggt |
20844337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 20844761 - 20844722
Alignment:
| Q |
18 |
acaaaagggagaagagcaattttctagtcgtaatcaatac |
57 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20844761 |
acaaaagggagaagagcaattttctagtcataatcaatac |
20844722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 157
Target Start/End: Original strand, 8467165 - 8467198
Alignment:
| Q |
124 |
gataaaataaccttatgcacgttacattcataat |
157 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
8467165 |
gataaaataaccttatgaacgttacattcataat |
8467198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University