View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21453_low_10 (Length: 262)
Name: NF21453_low_10
Description: NF21453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21453_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 233
Target Start/End: Complemental strand, 36605069 - 36604855
Alignment:
| Q |
19 |
ttatgttggttttctgttccacaatagtgatttgattcnnnnnnncttcgtttatatatgaccatcttgaacaaagtttgtatttgtctgtgtgtgttag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36605069 |
ttatgttggttttctgttccacaatagtgatttgattctttttttcttcgtttatatatgaccatcttgaacaaagtttgtatttgtctgtgtgtgttag |
36604970 |
T |
|
| Q |
119 |
ggtaagggtttatcaaataagattttcagtgatttttgtaaaatttattcctttagattgagtttgaatttaagtgatttatgttttgatgtgtgaaatt |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604969 |
ggtaagggtttatcaaatgagattttcagtgatttttgtaaaattgattcctttagattgagtttgaatttaagtgatttatgttttgatgtgtgaaatt |
36604870 |
T |
|
| Q |
219 |
ttcagtggaagacaa |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36604869 |
ttcagtggaagacaa |
36604855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University