View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21453_low_13 (Length: 227)
Name: NF21453_low_13
Description: NF21453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21453_low_13 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 35 - 227
Target Start/End: Complemental strand, 24108618 - 24108426
Alignment:
| Q |
35 |
tattgaatgttatttgaacatctaaaaaacatgacaatacatttaacatcgtataaaaatgcaccacttataactattgatcttaaataacctttctctt |
134 |
Q |
| |
|
||||||||||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24108618 |
tattgaatgttatttaaacatctaaaaaacttaacaatacatttaacatcgtataaaaatgcaccacttataactattgatcttaaataacctttctctt |
24108519 |
T |
 |
| Q |
135 |
tattaagcaacatcataaacatactacgtaccatatggtggtcgttaatttgaaatctagttaagttaatattaaaaactatgacactagttt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24108518 |
tattaagcaacatcataaacatactacgtaccatatggtggtccttaatttgaaatctagttaagttaatattaaaaactatgacactagttt |
24108426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University