View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21453_low_15 (Length: 214)
Name: NF21453_low_15
Description: NF21453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21453_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 93 - 207
Target Start/End: Original strand, 14597098 - 14597212
Alignment:
| Q |
93 |
gttgtcttttcatatataatattgtatataagtacaaaaatattttttatgacttatatgtttgtgtttgacaaagtatacataccaacaagaaatgaca |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14597098 |
gttgtcttttcatatataatattgtatataagtacaaaaatattttttatgacttatatgtttgtgtttgacaaagtatacataccaacaagaaatgaca |
14597197 |
T |
|
| Q |
193 |
gacacaggttctgct |
207 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
14597198 |
gacacagattctgct |
14597212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University