View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21453_low_7 (Length: 301)
Name: NF21453_low_7
Description: NF21453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21453_low_7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 14 - 301
Target Start/End: Original strand, 38919408 - 38919695
Alignment:
| Q |
14 |
atatttcgggatttgaccctagaagtggtatcgccaaagaaaatatagtctgcaaaatttttgtttttaatgctgacgtggttgaaaatctaagagcaaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38919408 |
atatttcgggatttgaccctagaagtggtatcgccaaagaaaatatagtttgcaaaatttttgtttttaatgctgacgtggttgaaaatctaagagcaaa |
38919507 |
T |
 |
| Q |
114 |
atatattaattttaatcctacacgcgttgaggctttatcggcttttatttggagtcgttatgttgatgttatttataatgatggtgtgcaaagaaactat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38919508 |
atatattaattttaatcctacacgcgttgaggctttatcggcttttatttggagtcgttatgttgatgttatttataatgatggtgtgcaaagaaactat |
38919607 |
T |
 |
| Q |
214 |
ggtgtggttcatgcggtgaatttgcgccaaaaaatggaaccatcattacctttagaatcgtttggtaactatttgcgatttacaataa |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38919608 |
ggtgtggttcatgcggtgaatttgcgccaaaaaatggaaccaccattacctttagaatcgtttggtaactatttgcgatttacaataa |
38919695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University