View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21454_low_1 (Length: 253)
Name: NF21454_low_1
Description: NF21454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21454_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 12 - 236
Target Start/End: Complemental strand, 26616654 - 26616430
Alignment:
| Q |
12 |
attattctaactcgctcgggtagttttgaaattgcaactgcagataatgttcttatatgtggaagtgtatcttctgctatggaactgttggcttcttctc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26616654 |
attattctaactcgctcgggtagttttgaaattgcaactgcagataatgttcttatatgtggaagtgtatcttctgctatggaactgttggcttcttctc |
26616555 |
T |
|
| Q |
112 |
cttactgtcagtcaattgagaaagtatttcttacaggaggtgctgagatttttaggtatatattgtttgattgtttgattttcataatcatgttaagctc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26616554 |
cttactgtcagtcaattgagaaagtatttcttacaggaggtgctgagatttttaggtatatattgtttgattgtttgattttcataatcatgttaagctc |
26616455 |
T |
|
| Q |
212 |
tttctttgttttaagagatgattgt |
236 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26616454 |
tttctttgttttaagagatgattgt |
26616430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University