View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21455_high_19 (Length: 256)
Name: NF21455_high_19
Description: NF21455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21455_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 22 - 246
Target Start/End: Original strand, 36356996 - 36357230
Alignment:
| Q |
22 |
atttgtttaattatttgtttgaaaaacaaaaactttgagatgtaatcatggaaaaaacagagtttgattcctgggtggaacaatcgtcggttagactttg |
121 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36356996 |
atttgtttaattatttgtttaaaaaaaaaaaactttgagatgtaatcatgggaaaaacagagtttgattcctgggtggaacaatcgtcggttagactttg |
36357095 |
T |
 |
| Q |
122 |
tacctcctggtcgaactctggaatactagggtctcattccacctgagaactggagggttaac----------nnnnnnnnnnctgagatgtgaaattgag |
211 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36357096 |
taccttctggtcgaactctggaatactagggtctcattccacctgagaactggagggttaacaaaaagaaaaacaaaaaaaactgagatgtgaaattgag |
36357195 |
T |
 |
| Q |
212 |
aggggttttgtttcattgatgaacttggttctgtg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36357196 |
aggggttttgtttcattgatgaacttggttctgtg |
36357230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University