View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21455_low_10 (Length: 397)
Name: NF21455_low_10
Description: NF21455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21455_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 6e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 193 - 385
Target Start/End: Original strand, 32642071 - 32642266
Alignment:
| Q |
193 |
gtcggttcgagaaagatcccaatcaccaaaaaaccaaatggactttactgcgttatctnnnnnnnnnn--ggactctactaacttgtctaacaagtcaat |
290 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32642071 |
gtcggttcgagaaagatccgaatcaccaaaaaaccaattggactttactgcgttatctaaaaaaaaaaaaggactctactaacttgtctaacaagtcaat |
32642170 |
T |
|
| Q |
291 |
gnnnnnnnnnn-actaagtcaatatgcatttttgtcgagcacgtctctctctacatgtaaatcacttcattttgatgttttaatttgttatcatat |
385 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32642171 |
gtttttttttttactaagtcaatatgcatctttgtcgagcacgtctctctctacatgtaaaacacttcattttgatgttttaatttgttatcatat |
32642266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 17 - 110
Target Start/End: Original strand, 32641895 - 32641988
Alignment:
| Q |
17 |
attaacatggcggtgccggctatggaggcggcggtggtgaggatggtttttgcagttgctaggtttgtctccgatgaggaggaggtaaaggaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32641895 |
attaacatggcggtgccggctatggaggcggcggtggtgaggatggtttttgcggttgctaggtttgtctccgataaggaggaggtaaaggaag |
32641988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University