View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21455_low_14 (Length: 315)
Name: NF21455_low_14
Description: NF21455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21455_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 6 - 299
Target Start/End: Original strand, 34660234 - 34660524
Alignment:
| Q |
6 |
actacaagtatatggttggttttgggtaaagaatataattgaaataaagctacggcaacaagcacatcacaagtctgagtagcagagtgaagtgtcaaaa |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34660234 |
actacaagcatatggttggttttgggtaaagaatacaattgaaataaagctacggcaacaagcacatcacaagtctgagtagcacagtgaagtgtcaaaa |
34660333 |
T |
 |
| Q |
106 |
tcaagctcaaaaaattggtctgatctcatggttaggttctgcacctgcaacacatggggtcctaacttcattcaattgtggttggggaagaattgggact |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34660334 |
tcaagctcaaaaaattggtctgatctcatggttaggttctgcacctgcaacacatggggtcctaacttcattcaattgtggttggggaagaattgggact |
34660433 |
T |
 |
| Q |
206 |
gaaaatcatgataactacatgttgatgagaaagtgataaggactaagtgcagctgcaatggtagtcatagtggaccactgttcttgtcattcat |
299 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34660434 |
gaaaatcatgataactacatgt---tgagaaagtgataaggaccaagtgcagctgtaatggtagtcatagtggaccacttttcttgtcattcat |
34660524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University