View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21455_low_22 (Length: 248)
Name: NF21455_low_22
Description: NF21455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21455_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 13122662 - 13122883
Alignment:
| Q |
1 |
ccttcctaggtcggttttcttttgtggaaccctcatttgtaagatagtgctacaatctttggtcaacattacaaactcttgtttgggtagtctcnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13122662 |
ccttcctaggtcggttttcttttgtggaaccctcatttgtaagatagtgctacaatctttggtcaacattacaaactcttgtttgggtagtctctttttt |
13122761 |
T |
|
| Q |
101 |
nnagataggagttctttcataaatttcgcataaatggacattctttcaagatattcaactagagagaagttaatttgcaagttggtttaaaactccatga |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13122762 |
ttagataggagttctttcataaacttcgcataaatggacattctttcaagatattcaactagagagatgttaatttgcaagttggtttaaaactccatga |
13122861 |
T |
|
| Q |
201 |
atgtatagaatttcttttcttg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13122862 |
atgtatagaatttcttttcttg |
13122883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 2 - 62
Target Start/End: Original strand, 13092718 - 13092778
Alignment:
| Q |
2 |
cttcctaggtcggttttcttttgtggaaccctcatttgtaagatagtgctacaatctttgg |
62 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13092718 |
cttcttaggtcggttttcttttgtggaaccctcatttgtaagatagtgctacaatctttgg |
13092778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University