View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21455_low_27 (Length: 227)
Name: NF21455_low_27
Description: NF21455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21455_low_27 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 53240022 - 53240242
Alignment:
| Q |
7 |
gaaggaatacattttaagagatgagcatgtaactaaacaatgggatagtttgaattttgtgttgcaacttcgatttatggtaacacacattcaaagaggg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53240022 |
gaaggaatacattttaagagatgagcatgtaactaaacaatgggatagtttgaattttgtgttgcaacttcgatttatggtaacacacattcaaagaggg |
53240121 |
T |
|
| Q |
107 |
aaaatgacatagccctctacttatacattgcacataccatacgaatttgtactcatacaactcaattgggccaaataaattgggcaattaaaagtttact |
206 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53240122 |
aaaatgacagagtcctctacttatacattgcacatactatacgaatttgtactcatacaactcaattgggccaaataaattgggcaattaaaagtttact |
53240221 |
T |
|
| Q |
207 |
tgtaattcaacagtttcaact |
227 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
53240222 |
tgtaattcaaaagtttcaact |
53240242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University