View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21457_high_8 (Length: 382)
Name: NF21457_high_8
Description: NF21457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21457_high_8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 254 - 382
Target Start/End: Complemental strand, 42538155 - 42538028
Alignment:
| Q |
254 |
tgttacggagatactcgttaacaaaaccattttctaatattagttggagaccgttattaggccaacaaacatgattaaaataaaaaattatcagccttgc |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| || | | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42538155 |
tgttacggagatactcgttaacaaaaccattt-ctaatattagttagaaatcattattaggccaacaaacatgattaaaataaaaaattatcagccttgc |
42538057 |
T |
 |
| Q |
354 |
tatatagtgcgaaatatatgcgcacgact |
382 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42538056 |
tatatagtgcgaaatatatgcgcacgact |
42538028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 348 - 382
Target Start/End: Complemental strand, 1933447 - 1933413
Alignment:
| Q |
348 |
ccttgctatatagtgcgaaatatatgcgcacgact |
382 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
1933447 |
ccttgctatatagtgcaaaatatatgcgcacgact |
1933413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University