View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21457_low_8 (Length: 382)

Name: NF21457_low_8

Description: NF21457

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF21457_low_8

[»] chr7 (1 HSPs)

[»] chr6 (1 HSPs)

Target: chr7 (Bit Score: 105; Significance: 2e-52; HSPs: 1)

Name: chr7

Description:

Target: chr7; HSP #1

Raw Score: 105; E-Value: 2e-52

Query Start/End: Original strand, 254 - 382

Target Start/End: Complemental strand, 42538155 - 42538028

Alignment:

Q	254	tgttacggagatactcgttaacaaaaccattttctaatattagttggagaccgttattaggccaacaaacatgattaaaataaaaaattatcagccttgc	353	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\| \|\| \| \| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	42538155	tgttacggagatactcgttaacaaaaccattt-ctaatattagttagaaatcattattaggccaacaaacatgattaaaataaaaaattatcagccttgc	42538057	T

Q	354	tatatagtgcgaaatatatgcgcacgact	382	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	42538056	tatatagtgcgaaatatatgcgcacgact	42538028	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)

Name: chr6

Description:

Target: chr6; HSP #1

Raw Score: 31; E-Value: 0.00000003

Query Start/End: Original strand, 348 - 382

Target Start/End: Complemental strand, 1933447 - 1933413

Alignment:

Q	348	ccttgctatatagtgcgaaatatatgcgcacgact	382	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	1933447	ccttgctatatagtgcaaaatatatgcgcacgact	1933413	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]