View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21458_low_1 (Length: 228)
Name: NF21458_low_1
Description: NF21458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21458_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 203
Target Start/End: Complemental strand, 25157961 - 25157777
Alignment:
| Q |
19 |
gttgctgcttctgctgcatatctatcttcggctgttgcgaatacgtattaaacgtaatctgcaacttcattgtggtcgtagcaatctttgctttcttctc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
25157961 |
gttgctgcttctgctgcatatctatcttcggctgatgcgaatatgtattaaacgtaatctgcaacttcaatgttgtcgtagcaatctttgctttcttctt |
25157862 |
T |
 |
| Q |
119 |
atggcttatcatacaccctaactacgtcaaattcaccgcaacagacgcatcccttactcaattcaatttcaaaaacaacattaca |
203 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
25157861 |
atggcttatcatacatcctaactacgtcaaattcaccgcaacagacgcatcccttactcagtttaatttcaaaaacaacattaca |
25157777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University