View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2145_high_2 (Length: 480)

Name: NF2145_high_2
Description: NF2145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2145_high_2
NF2145_high_2
[»] chr1 (1 HSPs)
chr1 (11-82)||(18540408-18540479)
[»] chr3 (1 HSPs)
chr3 (11-81)||(21453536-21453606)
[»] chr2 (3 HSPs)
chr2 (11-75)||(25450113-25450177)
chr2 (11-75)||(43292853-43292917)
chr2 (11-81)||(25454432-25454502)


Alignment Details
Target: chr1 (Bit Score: 68; Significance: 4e-30; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 11 - 82
Target Start/End: Complemental strand, 18540479 - 18540408
Alignment:
Q  11 gaacctgtgtatgtgatatgtttgttttcaatattatacgttgtgtgactatttgaattggtaatctcatat 82  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  18540479 gaacctgtgtatgtgatatgtttgttttcaatattatacgttgtgtgactatttgaattggtaatcccatat 18540408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 11 - 81
Target Start/End: Original strand, 21453536 - 21453606
Alignment:
Q  11 gaacctgtgtatgtgatatgtttgttttcaatattatacgttgtgtgactatttgaattggtaatctcata 81  Q
    |||| ||||||||||||||||||||||||| | |||| ||| |||||||||||||| ||| ||||| ||||    
T  21453536 gaacttgtgtatgtgatatgtttgttttcattcttatgcgtggtgtgactatttgatttgttaatcccata 21453606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 37; Significance: 0.00000000001; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 11 - 75
Target Start/End: Complemental strand, 25450177 - 25450113
Alignment:
Q  11 gaacctgtgtatgtgatatgtttgttttcaatattatacgttgtgtgactatttgaattggtaat 75  Q
    |||| ||||||||||||||||||||||||| | |||| ||| |||||||||||||| ||| ||||    
T  25450177 gaacttgtgtatgtgatatgtttgttttcattcttatgcgtggtgtgactatttgatttgttaat 25450113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 11 - 75
Target Start/End: Complemental strand, 43292917 - 43292853
Alignment:
Q  11 gaacctgtgtatgtgatatgtttgttttcaatattatacgttgtgtgactatttgaattggtaat 75  Q
    |||| ||||||||||||||||||||||||| | |||| ||| |||||||||||||| ||| ||||    
T  43292917 gaacttgtgtatgtgatatgtttgttttcattcttatgcgtggtgtgactatttgatttgttaat 43292853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 11 - 81
Target Start/End: Complemental strand, 25454502 - 25454432
Alignment:
Q  11 gaacctgtgtatgtgatatgtttgttttcaatattatacgttgtgtgactatttgaattggtaatctcata 81  Q
    |||| |||||||| ||||| |||||||||| | |||| ||| |||||||||||||| ||| ||||| ||||    
T  25454502 gaacttgtgtatgcgatatatttgttttcattcttatgcgtggtgtgactatttgatttgttaatcccata 25454432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University