View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2145_high_5 (Length: 319)
Name: NF2145_high_5
Description: NF2145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2145_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 18 - 311
Target Start/End: Original strand, 6060148 - 6060441
Alignment:
| Q |
18 |
aagaatttcttttctttcaacatatcttgcaaatcaagttgaagtaaatttagatcattcatttcacaagttcttcttgtaattgcttgtgttataatct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6060148 |
aagaatttcttttctttcaacatatcttgcaaatcaagttgaagtaaatttagatcattcatttcacaagttcttcttgtaattgcttgtgttataatct |
6060247 |
T |
 |
| Q |
118 |
ttgtaaccctcaaaatgtcaaactcttcagaaacacaaacccaagctttaaaatcaaatacatgcttcaaatactcgtcattgtacaccaactgagctaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6060248 |
ttgtaaccctcaaaatgtcaaactcttcagaaacacaaacccaagctttaaaatcaaatacatgcttcaaatactcatcattgtacaccaactgagctaa |
6060347 |
T |
 |
| Q |
218 |
agtagtttttcctacccctcccattcccacaataggtatcacaatcacttcttcaccatcatcactgttatcatctaacaaaaacttgatgatg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6060348 |
agtagtttttcctacccctcccattcccacaataggtatcacaatcacttcttcaccattatcactgttatcatctaacaaaaacttgatgatg |
6060441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University