View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2145_high_7 (Length: 243)
Name: NF2145_high_7
Description: NF2145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2145_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 21 - 230
Target Start/End: Original strand, 38761995 - 38762204
Alignment:
| Q |
21 |
tatatataatttaggtgatctattgatcataaaagcaaatcagctagtaagatgaaaataaacaatccatatttggttgtggtaatcatacaagccatat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38761995 |
tatatataatttaggtgatctattgatcataaaagcaaatcagctagtaagatgaaaagaaacaatccatatttggttgtggtaatcatacaagccatat |
38762094 |
T |
 |
| Q |
121 |
atgctgctatgtttcttctgtcaaaagctgcattcgaccatggcatgaacaatttcgtctttgttttctacagacaatctgcagctactatttttctcac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762095 |
atgctgctatgtttcttctgtcaaaagctgcattcgaccatggcatgaacaatttcgtctttgttttctacagacaatctgcagctactatttttctcac |
38762194 |
T |
 |
| Q |
221 |
accctttgct |
230 |
Q |
| |
|
||| |||||| |
|
|
| T |
38762195 |
accttttgct |
38762204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 128 - 197
Target Start/End: Original strand, 43620913 - 43620982
Alignment:
| Q |
128 |
tatgtttcttctgtcaaaagctgcattcgaccatggcatgaacaatttcgtctttgttttctacagacaa |
197 |
Q |
| |
|
||||||||| || |||||||||||||| || |||||||| ||||||||| ||||||| ||||| |||||| |
|
|
| T |
43620913 |
tatgtttctactctcaaaagctgcatttgatcatggcatcaacaatttcatctttgtgttctatagacaa |
43620982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University